Genomics and you

On the Computer

Transcribe and translate a gene at the Genetic Science Learning Center at the University of Utah

By hand

Translate the following sequence in all 6 reading frames using the codon table from the above exercise.

aatcaaagacttattatctttttcatatc

On the Computer

Translate this longer piece of DNA using the Open Reading Frame Finder at the National Center for Biotechnology Information

tcctattatggttcgactccccaaaccaaaacatcagagatatatactgttgtcttattc
caatcagcataacttgagttactatcaccaaacgaataatcatctgtttgtgtatagttt
gtccagtctaccttagaaaatcttccttgaacttcaatactttgccctgcgtttaaagtt
ccggcagcggacttaaatgaaaattctagatagtaatctgcatttgtttttggtgtactc
atctttacgaaagtaccatttacattggaactaccaatcgtcgaataatcacaccagaat
gcctgatccttttcgccattgattgtataataatagcgaatcttaacatcggataagttg
attgcagtagttccggtgttaattaatttaattcttggtgcaatgccattcgttgttgca
gaagaatttccattaaacatttgaagtttaatatttcctgttggagtaacaacagaagaa
tccttaatggtaactgctaagactggatttgtccctttattcatttcaaatacaatagat
tgacttcctactgcaaattgacttaaataagaagatagaatcgtcactgttgttccggaa
acggtataatcagttccagttaccaggctcttagacccattcttaagtccagctaaggta
ttgccatttggtgtaagcgtaataactatattttcctgttttccgctagccttatcaaag
acagcagaatttggattaatggatgcacttggagaagtatctactaaagtcacttttaat
gttgcatcgttaccgccactaaatacaaatgttaaagtaaccgtactagcgctctgtgct
aagaaataattcttagataacgttactacattaccagatacagtataatcagtacctttc
gttaaaaccgttgttccattcttaaccgctgttaatgtattaccattatagttaatggtt
actggtatatctgcggatacagctgggtttttgtcaaagtttgctgtagtcttatcaaga
cttgcagaaggaacacccgtctttggctcattaccaaatactaatttaccattatcatac
aatggtatatatgtggtctttacggtatttcctgaactaacattagcaatttgtgtaaag
gagtagtcattggaattgtcccatatattaacgttttgtggaccagcaattctaaattgt
acttctttcttatatgcagactgtccaccaggataaatcttagttccagagaagtctaca
ttcacataatagatattattcgcagcatcccaaggaagcaatgccgatgtggttgctcca
ttgttataatttgtcgataccgtaaaatcattctttgtatatccctttgctacatattcc
gagatatcaataaaatacttaaaggataatttatcggtaacacgagctggccaacctgtc
tcattgaaaaccaatgcctttacttcgataaaagatggaccagaggcattaataccagct
tgaataaataactcatcgtttgttactgtttcgattgccttaaagtttgcaattggtgtt
ccgccatatgttttataaactttagccaatgcgccaacaaaacctgcattatagtcacaa
gcgatttcattgtttacataattattaatgttatcctcataactatcattattaccaggt
ccacctactaaagcaccataaatggtgtgtctatggtaatttggctccgtctgactgtct
gcccatgaactatgagcagttctatgatgaggtcttgttggagaatttacaccatatcca
accacaaaacttcttccggtacttcctaatgcataatctacctgctgtttcgcaaatgca
ttgtaagtactaacttttccagcactacatccgctccaatcagcataaacacttgctaga
aatgctgttgtcgtcgcatatcttaatgcaccccaggaatctaaccaagcaagtcctttt
ggtgtataagtaatacgactaccattataccctgtagtccaatagtcaagatgcatttca
atattgttcttataaattgctttatttgtaattcttgctaataataaagctgcaccatag
tgaacatcatcccagttttgtgcccacttataacttaatgtggaagattgaggttctgtt
ccccatttggctacataagattctgccttatccaaataggtcgcttctccacttgcaagg
taaatccatgtagctgcccaggataattcatcataaaatccactataggaagtatagaac
ccacttgctgctgtatatccagcatcgctttttgttgtatctgcaaaattaaaaagctct
tttgcatgacgaaggcaagttgctgaataagtagggtcttttgtcttatatataagtgct
gttgctgcaagagctgctgctgcttctcctactacagtagaacctgggttatttaaatca
accttataggacggtctagccatctgcataacttcagcaggtccccaccaagagtgatct
gtatttccattaccaacctgataataaaatacatttgcttgtggatgacatttaattagg
taatcactagaccacttaatttcatctaataaataacttaattggcctgcctttgaaaga
gtagcctcttcttcatatactgcccatgctaacattgttacagtataagccaaaggaaga
ttaaattttacatgatcaccagcatcataccagccaccagttagatccaaaccaacatct
gctccatcggttaaaccagagtcacctctccaattattccgaatggtacttggcagttta
ccagaacgttgaaactcataaaacatgattgatttttgaagagcttctccgtaattataa
ttggtttccgctgcgtcagctttcgatggtgccatggatatcagaagtgttatcactaat
aaaagacttattatctttttcatatctctc

How many proteins are encoded by this sequence?

Resources and Links

AttachmentSize
2010_STEM_genomics.pdf116.98 KB